Sequence ID | >WENV170001091 |
Genome ID | AGBJ01003774 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 638 |
End posion on genome | 714 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
tttattatgt |
tRNA gene sequence |
GCGCCCATAGCTCAGATGGACAGAGTAACGGACTACGAATCCGTAGGTCGGGTGTTCGAA |
Downstream region at tRNA end position |
ttttgttctc |
Secondary structure (Cloverleaf model) | >WENV170001091 Arg ACG t ACCA ttttgttctc G - C C - G G - C C - G C - G C - G A - T T A T C C C A C A A G A A | | | | | G T C T C G G G G T G C G | | | + T T G G A G T A C A A AGGTC A - T C - G G - C G - C A - T C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |