Sequence ID | >WENV170001094 |
Genome ID | AGBJ01003970 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 396 |
End posion on genome | 481 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
aaaaaaagca |
tRNA gene sequence |
GCCCAGGTGGCGGAATTGGCAGACGCGGCAGGTTTAGGACCTGTTGGGAATTTCCTGTGG |
Downstream region at tRNA end position |
aaaaccgagc |
Secondary structure (Cloverleaf model) | >WENV170001094 Leu TAG a ACCA aaaaccgagc G - C C - G C - G C - G A - T G - C G - C T A T C C C T C A T A A G | | | | | G T G G C G G G G A G C G | | | T T G A C G C C A G G TGGGAATTTCCTGT G + T C - G A - T G - C G - C T A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |