Sequence ID | >WENV170001096 |
Genome ID | AGBJ01004382 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 335 |
End posion on genome | 262 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
caggcagatt |
tRNA gene sequence |
GCCCGAGTAGCGCAATGGTAGCGCAACCGACTTGTAATCGGTAGGTTAGTGGGTTCGAGT |
Downstream region at tRNA end position |
gttttaggct |
Secondary structure (Cloverleaf model) | >WENV170001096 Thr TGT t TCgg gttttaggct G - C C - G C - G C - G G - C A - T G - C T G T T C C C C A A A A + | | | G T C G C G G T G G G C G | | | | T T G G C G C T A A AGGTTA A - T C - G C - G G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |