Sequence ID | >WENV170001099 |
Genome ID | AGBJ01004481 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 74 |
End posion on genome | 3 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
aaaatatcat |
tRNA gene sequence |
GCCTGCGTGGCCCAATGGTAGAGCAATTGATTTGTAATCAATAGGTTGAGGGTTCGATTC |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170001099 Thr TGT t Tttn nnnnnnnnnn G - C C - G C - G T - A G - C C - G G - C T T T T T C C C A A A G + | | | | G T C C C G G A G G G C G | | | T T G G A G C T A A AGGTT A - T T - A T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |