Sequence ID | >WENV170001101 |
Genome ID | AGBJ01004503 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 408 |
End posion on genome | 332 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aaaaacccat |
tRNA gene sequence |
GGCGGTGTAGCTCAGGTGGTTAGAGCATACGGCTCATATCCGTAGCGTCCGGGGTTCAAT |
Downstream region at tRNA end position |
tattgattgt |
Secondary structure (Cloverleaf model) | >WENV170001101 Met CAT t ACCA tattgattgt G - C G - C C - G G - C G - C T - A G - C T T T G T C C C A G G A A | + | | | A T C T C G C G G G G C G | | | | T T G G A G C T T A A GCGTC T - A A - T C - G G - C G - C C T T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |