Sequence ID | >WENV170001102 |
Genome ID | AGBJ01004535 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 726 |
End posion on genome | 802 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
aaaaccacgt |
tRNA gene sequence |
GGGCGATTAGCTCAGGTGGATAGAGCGTTGGTCTCCGGAACCAGAGGTCGCGAGTTCGAG |
Downstream region at tRNA end position |
tatatattac |
Secondary structure (Cloverleaf model) | >WENV170001102 Arg CCG t ACCA tatatattac G - C G - C G - C C - G G - C A - T T - A T G T C G C C C A G G A A | | | | G T C T C G G C G A G C G | | | | T T G G A G C A T A G AGGTC T + G T - A G - C G - C T - A C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |