Sequence ID | >WENV170001106 |
Genome ID | AGBJ01004567 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 587 |
End posion on genome | 663 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
ggcataaaat |
tRNA gene sequence |
CGGGACGTGGCGCAGTCTGGAAGCGCACCTGAATGGGGTTCAGGGGGTCGCGAGTTCAAA |
Downstream region at tRNA end position |
gtaatttcaa |
Secondary structure (Cloverleaf model) | >WENV170001106 Pro GGG t ACCA gtaatttcaa C - G G - C G - C G - C A - T C - G G - C T A T C G C T C A T G A G | | | | | A C C G C G G C G A G C T | | | | T T G G C G C G A A A GGGTC C - G C - G T - A G - C A - T A T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |