Sequence ID | >WENV170001107 |
Genome ID | AGBJ01004581 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 184 |
End posion on genome | 109 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tgaaaaatga |
tRNA gene sequence |
CGCGGAGTGGAGCAGTTGGTAGCTCGTTGGGCTCATAACCCAAAGGTCAGAGGTTCGAAT |
Downstream region at tRNA end position |
atgaaaggtc |
Secondary structure (Cloverleaf model) | >WENV170001107 Met CAT a ACTA atgaaaggtc C T G - C C - G G - C G - C A - T G - C T A T T C T C C A T G A G | | | | | G T C G A G A G A G G C G | | | | T T G G C T C T A G AGGTC T - A T - A G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |