Sequence ID | >WENV170001108 |
Genome ID | AGBJ01004606 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 71 |
End posion on genome | 145 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ctttcggtgt |
tRNA gene sequence |
GGCGCGGTAGCCAAGTGGCTTCGGCAGAGGACTGCAAATCCTCGTACGTGGGTTCGATTC |
Downstream region at tRNA end position |
atttgcccgg |
Secondary structure (Cloverleaf model) | >WENV170001108 Cys GCA t TCTA atttgcccgg G - C G - C C - G G - C C - G G - C G - C T T T C A C T C A T G A A | | | + | G G A C C G G T G G G C G | | | T T C C G G C T T A GTAC G - C A - T G - C G - C A - T C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |