Sequence ID | >WENV170001111 |
Genome ID | AGBJ01004843 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 744 |
End posion on genome | 819 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
aaagagaaat |
tRNA gene sequence |
AGGTCCGTAGCTCAACTGGCTAGAGCACCGGATTCCAAATCCGGCGGTTGCGGGTTCAAG |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170001111 Trp CCA t GCCn nnnnnnnnnn A - T G - C G - C T - A C - G C - G G - C T G T C G T C C A C A A A | | + | | A T C T C G G C G G G C G | | | | T T G G A G C C T A A CGGTT C - G C - G G - C G - C A - T T A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |