Sequence ID | >WENV170001112 |
Genome ID | AGBJ01005070 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 192 |
End posion on genome | 264 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
tgtcatgcca |
tRNA gene sequence |
CGGGGTGTAGCGCAGGGGTAGCGCGCATGGTTTGGGACCATGAGGTCGGAGGTTCAAATC |
Downstream region at tRNA end position |
atacatcggg |
Secondary structure (Cloverleaf model) | >WENV170001112 Pro TGG a ACac atacatcggg C - G G - C G - C G - C G - C T - A G - C T A T T C T C C A G A A + | | | | A G C G C G G G A G G C G | | | | T T G G C G C T A G AGGTC C - G A - T T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |