Sequence ID | >WENV170001116 |
Genome ID | AGBJ01005284 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 583 |
End posion on genome | 508 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
aaattttgat |
tRNA gene sequence |
AGGTCTGTAGTTCAATTGGAAGAGCACCGGTCTCCAAAACCGACTGTTGGGGGTTCAAAT |
Downstream region at tRNA end position |
aatatttgag |
Secondary structure (Cloverleaf model) | >WENV170001116 Trp CCA t GCAA aatatttgag A - T G - C G - C T - A C - G T - A G - C T A T C T C C C A T A A A | + | | | A T C T T G G G G G G C G | | + | T T G G A G C A A A CTGTT C A C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |