Sequence ID | >WENV170001118 |
Genome ID | AGBJ01005362 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 459 |
End posion on genome | 535 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ggcacagtga |
tRNA gene sequence |
GGACGATTAGCTCAGCTGGCTAGAGCGCGTCGCTTACATCGACGAGGTCGCAGGTTCGAG |
Downstream region at tRNA end position |
aaaaatgccg |
Secondary structure (Cloverleaf model) | >WENV170001118 Val TAC a ACAA aaaaatgccg G - C G - C A - T C - G G - C A - T T - A T G T C G T C C A C G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C C T A G AGGTC C - G G - C T - A C - G G - C C T T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |