Sequence ID | >WENV170001121 |
Genome ID | AGBJ01005398 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 206 |
End posion on genome | 283 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
catctcttat |
tRNA gene sequence |
CGGGGTGTAGCGCAGTCTGGCTAGCGTGCTATCTTGGGGTGATAGAGGTCGCCGGTTCAA |
Downstream region at tRNA end position |
gttttaccta |
Secondary structure (Cloverleaf model) | >WENV170001121 Pro GGG t ACCA gttttaccta C - G G - C G - C G + T G - C T - A G - C T G T T G G C C A C T G A A + | | | | A T C G C G G C C G G C G | | | + T T G G C G T C T A G AGGTC C - G T - A A - T T - A C - G T T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |