Sequence ID | >WENV170001122 |
Genome ID | AGBJ01005579 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 342 |
End posion on genome | 418 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
tgtaaccagc |
tRNA gene sequence |
GGGGGTGTAGTTCAGATGGTTAGAACGTCTGCCTGTCACGCAGAAGGTCGCGAGTTCGAG |
Downstream region at tRNA end position |
tttttattca |
Secondary structure (Cloverleaf model) | >WENV170001122 Asp GTC c GCCA tttttattca G - C G - C G - C G + T G - C T - A G - C T G T T G C C C A A G A A + | | | G T C T T G G C G A G C G | | | | T T G G A A C T T A G AGGTC T - A C - G T - A G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |