Sequence ID | >WENV170001124 |
Genome ID | AGBJ01005859 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 89 |
End posion on genome | 162 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
tgattctatc |
tRNA gene sequence |
GGCCCCATCGTCTAGTGGTCTAGGACACTGGGTTCTCAGTCCGGTAACACCGGTTCGACT |
Downstream region at tRNA end position |
ttttattcaa |
Secondary structure (Cloverleaf model) | >WENV170001124 Glu CTC c ACat ttttattcaa G - C G + T C - G C - G C - G C - G A - T T C T T G G C C A T G A C | | | | | G G T C T G A C C G G C G + | | | T T T G G A C C T A A TAAC C - G T + G G - C G - C G + T T G T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |