Sequence ID | >WENV170001125 |
Genome ID | AGBJ01006244 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 445 |
End posion on genome | 358 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
attggtaaaa |
tRNA gene sequence |
GGGGATGTGTTGGAAATAGGTAGACAAAGAGGTCTCAAAAACCTCTGGACGCAAGTCCGT |
Downstream region at tRNA end position |
tttttttatt |
Secondary structure (Cloverleaf model) | >WENV170001125 Leu CAA a ACTA tttttttatt G - C G - C G - C G - C A - T T - A G - C T C T C T C C C A T A A A G | | | | | G A G G T T G A G G G C G | | | T T G A C A A T A G A TGGACGCAAGTCCGT G - C A - T G - C G - C T - A C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |