Sequence ID | >WENV170001126 |
Genome ID | AGBJ01006305 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 408 |
End posion on genome | 333 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
ccaattactT |
tRNA gene sequence |
GCGCCTGTAGCTCAGAAGGATAGAGCAGCGGTTTCCTAAACCGCGGGTCGCAGGTTCAAT |
Downstream region at tRNA end position |
acaaattctt |
Secondary structure (Cloverleaf model) | >WENV170001126 Arg CCT T ATta acaaattctt G - C C - G G - C C - G C - G T - A G - C T T T C G T C C A A G A A | | | | | A A C T C G G C A G G C G | | | | T T G G A G C A T A A GGGTC G - C C - G G - C G - C T - A T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |