Sequence ID | >WENV170001130 |
Genome ID | AGBJ01006416 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 460 |
End posion on genome | 536 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
tttatttagt |
tRNA gene sequence |
GCACTCGTAGCTCAGCTGGATAGAGCATCGCCCTTCTAAGGCGAGGGTCTTAGGTTCGAA |
Downstream region at tRNA end position |
cttactattg |
Secondary structure (Cloverleaf model) | >WENV170001130 Arg TCT t ACCA cttactattg G + T C - G A - T C - G T + G C - G G - C T A T A A T C C A C G A A | | | | | G T C T C G T T A G G C G | | | | T T G G A G C A T A A GGGTC T - A C - G G - C C - G C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |