Sequence ID | >WENV170001133 |
Genome ID | AGBJ01006683 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 28 |
End posion on genome | 104 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
ttgctttaat |
tRNA gene sequence |
GGGGGTGTAGCTTAGTGGCTTAAAGCGCCGCCCTGTCACGGCGGAGATCGCCGGTTCAAA |
Downstream region at tRNA end position |
cgttggtctt |
Secondary structure (Cloverleaf model) | >WENV170001133 Asp GTC t GCCA cgttggtctt G - C G - C G - C G - C G - C T + G G - C T A T T G G T C A T G A A + | | + | A G T T C G G C C G G C G | | | | T T C A A G C T T A G AGATC C - G C - G G - C C - G C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |