Sequence ID | >WENV170001134 |
Genome ID | AGBJ01006957 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 336 |
End posion on genome | 261 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
cgaaacttga |
tRNA gene sequence |
GGGCCCGTGGTCTAGTGGCTATGACGCCACCTTGACATGGTGGAGGTCGAGGGTTCAAAT |
Downstream region at tRNA end position |
ccattactcc |
Secondary structure (Cloverleaf model) | >WENV170001134 Val GAC a ACCA ccattactcc G - C G - C G - C C - G C - G C - G G - C T A T C T C C C A T G A G | | | | | A G T C T G G A G G G C G | | | T T C T G A C T A G AGGTC C - G C - G A - T C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |