Sequence ID | >WENV170001138 |
Genome ID | AGBJ01007209 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 278 |
End posion on genome | 354 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
catgtaatat |
tRNA gene sequence |
AGGCCAGTAGCCCTAACGGTTAGAGCACCGGACTCCAAATCCGGGTGATGGGGGTTCGAA |
Downstream region at tRNA end position |
ctcgttcgaa |
Secondary structure (Cloverleaf model) | >WENV170001138 Trp CCA t GCCA ctcgttcgaa A - T G - C G - C C - G C - G A - T G - C T A T C T C C C A A A T A | + | | | G C C C C G G G G G G C G | | | T T G G A G C T T A A GTGAT C - G C - G G - C G - C A - T C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |