Sequence ID | >WENV170001139 |
Genome ID | AGBJ01007321 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 137 |
End posion on genome | 212 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
cacattacga |
tRNA gene sequence |
GCGGGAGTAGCTCAGCCGGTAGAGCATCAGCCTTCCAAGCTGAATGTCGCGAGTTCGAAT |
Downstream region at tRNA end position |
ggatataatt |
Secondary structure (Cloverleaf model) | >WENV170001139 Gly TCC a TCCA ggatataatt G - C C - G G - C G - C G - C A - T G - C T A T T G C T C A C G A A + | | | | G C C T C G G C G A G C G | | | | T T G G A G C T A A ATGTC T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |