Sequence ID | >WENV170001141 |
Genome ID | AGBJ01007321 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 402 |
End posion on genome | 478 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
catcaaatgc |
tRNA gene sequence |
GCGCCGGTAGCTCAGTGGATTAGAGCACCGGACTTCGGATCCGGGTGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
tttgacgaca |
Secondary structure (Cloverleaf model) | >WENV170001141 Arg TCG c GCCA tttgacgaca G - C C - G G - C C - G C - G G - C G - C T A T C T C C C A T G A A | + | | | G G C T C G G G G G G C G | | | | T T A G A G C T T A A GTGTC C - G C - G G - C G - C A - T C A T G T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |