Sequence ID | >WENV170001143 |
Genome ID | AGBJ01007440 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 294 |
End posion on genome | 218 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
catttttttt |
tRNA gene sequence |
GGCGACGTAGCTCAGTTGGTTAGAGCATCGGAATCATAATCCGAGTGTCCTGGGTTCGAA |
Downstream region at tRNA end position |
atttttttat |
Secondary structure (Cloverleaf model) | >WENV170001143 Met CAT t ACCA atttttttat G + T G - C C - G G - C A - T C - G G - C T A T G T C C C A T G A A | | | | G T C T C G C T G G G C G | | | | T T G G A G C T T A A GTGTC T - A C - G G - C G - C A - T A A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |