Sequence ID | >WENV170001144 |
Genome ID | AGBJ01007440 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 166 |
End posion on genome | 90 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
cgattgtcga |
tRNA gene sequence |
GCGCCAGTAGCTCAGCCGGATAGAGCAACGGCCTTCTAAGCCGTAGGTCAGAGGTTCGAA |
Downstream region at tRNA end position |
ttcctttaga |
Secondary structure (Cloverleaf model) | >WENV170001144 Arg TCT a ACCA ttcctttaga G + T C - G G - C C - G C - G A - T G - C T A T T C T C C A C G A A | | | | | G C C T C G A G A G G C G | | | | T T G G A G C A T A A AGGTC A - T C - G G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |