Sequence ID | >WENV170001145 |
Genome ID | AGBJ01007554 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 218 |
End posion on genome | 291 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
tttttgagaa |
tRNA gene sequence |
TGGGTTGTCGTCTAACGGTAGGACATATGACTCTGGCTCATACGATCGGGGTTCAATTCC |
Downstream region at tRNA end position |
ttattttttt |
Secondary structure (Cloverleaf model) | >WENV170001145 Gln CTG a GCAA ttattttttt T - A G - C G - C G - C T + G T - A G - C T T T G T C C C A A A C | + | | | A C T C T G C G G G G C G + | | | T T G G G A C T A A CGAT T - A A - T T - A G - C A - T C C T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |