Sequence ID | >WENV170001147 |
Genome ID | AGBJ01007554 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 382 |
End posion on genome | 456 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
tactaccaat |
tRNA gene sequence |
GCGCCCGTAGATCAACTGGATAGATCGTCTGGCTACGGACCAGAAGGCTGAGGGTTCGAA |
Downstream region at tRNA end position |
tttttaaatt |
Secondary structure (Cloverleaf model) | >WENV170001147 Arg ACG t ACtt tttttaaatt G + T C - G G - C C - G C - G C - G G - C T A T C T T C C A C A A A | | + | | G T C T A G G A G G G C G | | | | T T G G A T C A T A G AGGCT T - A C - G T - A G - C G - C C A T G A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |