Sequence ID | >WENV170001148 |
Genome ID | AGBJ01007675 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 461 |
End posion on genome | 388 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
nnnnnnnnnt |
tRNA gene sequence |
GGCGACGTACCCAAGTGGCTAAGGGGGAGGTCTGCAAAATCTTTACGCGCCGGTTCGAAT |
Downstream region at tRNA end position |
taaaatgccg |
Secondary structure (Cloverleaf model) | >WENV170001148 Cys GCA t TCat taaaatgccg G - C G - C C - G G - C A - T C - G G - C T A T C G G C C A T G A A | | | | | G G A C C C G C C G G C G | | | T T C A G G G T A G TACGC G + T A - T G - C G + T T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |