Sequence ID | >WENV170001152 |
Genome ID | AGBJ01007809 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 15 |
End posion on genome | 90 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
tctttaagtc |
tRNA gene sequence |
GGCTCCATAGCTCAGTTGGTAGAGCAAAGGATTGAAAATCCTTGTGTCGGCGGTTCGATT |
Downstream region at tRNA end position |
ttatctttca |
Secondary structure (Cloverleaf model) | >WENV170001152 Phe GAA c ACCA ttatctttca G - C G - C C - G T C C - G C - G A - T T T T C T G C C A T G A A | + | | | G T C T C G G G C G G C G | | | | T T G G A G C T A A GTGTC A - T A - T G - C G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |