Sequence ID | >WENV170001153 |
Genome ID | AGBJ01007955 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 390 |
End posion on genome | 314 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
atagagggcg |
tRNA gene sequence |
CGGGGCGTAGCGCAGTCTGGTAGCGCGCAGCGTTCGGGACGCTGAGGTCGGAGGTTCGAA |
Downstream region at tRNA end position |
tgtcaatcca |
Secondary structure (Cloverleaf model) | >WENV170001153 Pro CGG g ACCA tgtcaatcca C - G G - C G - C G - C G - C C - G G - C C A T T C T C C A T G A A + | | | | G C C G C G G G A G G C T | | | | T T G G C G C G T A G AGGTC C - G A - T G - C C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |