Sequence ID | >WENV170001157 |
Genome ID | AGBJ01010059 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 220 |
End posion on genome | 147 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
nnnnnnnnnn |
tRNA gene sequence |
GCGGGATTAGTATAGCGGCAGTACGCTTCCTTCCCAAGGAAGAAGCGCCGGTTCGATTCC |
Downstream region at tRNA end position |
tttgccgatg |
Secondary structure (Cloverleaf model) | >WENV170001157 Gly CCC n TCCA tttgccgatg G - C C - G G - C G - C G - C A - T T - A T T T T G G C C A G A A + | | | | G C T A T G G C C G G C G + | | | T T G G T A C C A G AAGC C - G T - A T - A C - G C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |