Sequence ID | >WENV170001158 |
Genome ID | AGBJ01010059 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 103 |
End posion on genome | 29 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
cgctcttttt |
tRNA gene sequence |
GCCAGAGTAGCTCAGTGGAAGAGCAGAGCTTTCGTAAAGCTCAGGTCATCGGTTCAAATC |
Downstream region at tRNA end position |
ctaaatgaaa |
Secondary structure (Cloverleaf model) | >WENV170001158 Thr CGT t TCCA ctaaatgaaa G - C C - G C - G A - T G - C A - T G - C T A T T A G C C A G A A | | | | | A T C T C G A T C G G C G | | | | T T G G A G C A A A AGGTC G - C A - T G - C C - G T - A T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |