Sequence ID | >WENV170001159 |
Genome ID | AGBJ01010122 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 192 |
End posion on genome | 116 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
actttaatat |
tRNA gene sequence |
GGGGGTGTAGCTCAATCGGCCAGAGTCCGTGCCTGTCACGCACGTGGTTGCCGGTTCGAA |
Downstream region at tRNA end position |
cactgaagac |
Secondary structure (Cloverleaf model) | >WENV170001159 Asp GTC t GCCA cactgaagac G - C G - C G - C G - C G - C T - A G - C T A T T G G C C A T A A A + | | | | G C C T C G G C C G G C G | | | + T T G G A G T C C A C TGGTT C - G G - C T - A G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |