Sequence ID | >WENV170001160 |
Genome ID | AGBK01000008 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 230 |
End posion on genome | 302 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
tttagagtgt |
tRNA gene sequence |
GCCCCGGTAGTGTAGGGGATATCATGTGGCCCTGTCGAGGCCATGACCCGGGTTCAAATC |
Downstream region at tRNA end position |
ttacctttta |
Secondary structure (Cloverleaf model) | >WENV170001160 Asp GTC t GCtt ttacctttta G - C C - G C - G C - G C - G G - C G - C T A T G G C C C A G G A A | | | | | A G T G T G C C G G G C G | | + T T A T C A T T A G TGAC T - A G - C G - C C - G C - G C A T G G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |