Sequence ID | >WENV170001161 |
Genome ID | AGBK01000008 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 427 |
End posion on genome | 502 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
agttttccag |
tRNA gene sequence |
GGGCCTGTGGCGCAGTCTGGCTAGCGCACCGGCCTTTTAAGCCGGTTGTCGCGGGTTCAA |
Downstream region at tRNA end position |
tgagatgtgt |
Secondary structure (Cloverleaf model) | >WENV170001161 Lys TTT g GCtg tgagatgtgt G - C G - C G - C C - G C - G T + G G - C T A T C G C C C A C T G A G | | | | | A T C G C G G C G G G C G | | | | T T G G C G C C T A A TTGTC C - G C - G G - C G - C C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |