Sequence ID | >WENV170001162 |
Genome ID | AGBK01000032 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 4773 |
End posion on genome | 4698 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
tttactttga |
tRNA gene sequence |
AGCCCCGTGGTGTAGTGGTCAAGCATGCGAGGTTCTGGTCCTCGTGACGGCGGTTCGAAT |
Downstream region at tRNA end position |
tctaaccaaa |
Secondary structure (Cloverleaf model) | >WENV170001162 Gln CTG a ACTA tctaaccaaa A - T G - C C - G C - G C - G C - G G - C T A T C C G C C A T G A G | | | | | G G T G T G G G C G G C G + | | + T T T G C A T C A A G TGAC C - G G - C A - T G - C G - C T T T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |