Sequence ID | >WENV170001165 |
Genome ID | AGBK01000154 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 1661 |
End posion on genome | 1586 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
acagttttac |
tRNA gene sequence |
GGGGATGTAGCTCAGCAGGGAGAGCGCCGCGTTCGCAACGCGGAGGTCGGCGGTTCGAAT |
Downstream region at tRNA end position |
gatttttcta |
Secondary structure (Cloverleaf model) | >WENV170001165 Ala CGC c ACCA gatttttcta G - C G - C G + T G - C A - T T - A G - C T A T T C G C C A C G A A + | | | | G A C T C G G G C G G C G | | | | T T G G A G C G A G AGGTC C - G C - G G - C C - G G - C T A T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |