Sequence ID | >WENV170001166 |
Genome ID | AGBK01000165 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 3026 |
End posion on genome | 3101 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
ctttttttga |
tRNA gene sequence |
GGGCCGGTAGTTTAGCGGTATGAACGTCCGCTTGGCATGCGGAAGGTCGTGGGTTCAAAT |
Downstream region at tRNA end position |
ctcctacgtg |
Secondary structure (Cloverleaf model) | >WENV170001166 Ala GGC a ACTA ctcctacgtg G - C G - C G + T C - G C - G G - C G - C T A T C A C C C A C G A A | | | | | A G T T T G G T G G G C G + | | | T T T G A A C A T G AGGTC T - A C - G C - G G - C C - G T T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |