Sequence ID | >WENV170001167 |
Genome ID | AGBK01000238 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 372 |
End posion on genome | 297 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
tctgctcaaa |
tRNA gene sequence |
GCCGGTGTAGCTCAATCGGCAGAGCAGTCGACTTGTAATCGACAGGTTGCCAGTTCAAGT |
Downstream region at tRNA end position |
tgaaggcaga |
Secondary structure (Cloverleaf model) | >WENV170001167 Thr TGT a TCCA tgaaggcaga G - C C - G C - G G - C G - C T + G G - C T G T C G G T C A T A A A | | | | | A C C T C G G C C A G C G | | | | T T G G A G C C A A AGGTT G - C T - A C - G G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |