Sequence ID | >WENV170001168 |
Genome ID | AGBK01000238 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 241 |
End posion on genome | 156 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
tatgatattt |
tRNA gene sequence |
GGAGGGGTACCGAAGTGGCCAAACGGAGCGGACTGTAAATCCGTTGGCAGGTGCCTTCGG |
Downstream region at tRNA end position |
taccctattt |
Secondary structure (Cloverleaf model) | >WENV170001168 Tyr GTA t ACCA taccctattt G - C G - C A - T G - C G - C G - C G - C T A T C T C C C A T G A A | + | | | A G A G C C G G G G G C G | | | T T C A C G G C A A A TGGCAGGTGCCTTC G + T C - G G - C G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |