Sequence ID | >WENV170001169 |
Genome ID | AGBK01000238 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 77 |
End posion on genome | 2 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
atcgtaaggt |
tRNA gene sequence |
GCCCGCGTAGTTCAGTCGGAAGAACATCCCGTTGGTAATGGGAAGGCCGCCGGTTCGATT |
Downstream region at tRNA end position |
gnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170001169 Thr GGT t TCCA gnnnnnnnnn G - C C - G C - G C - G G - C C - G G - C T T T C G G C C A T G A A | | | | | G C C T T G G C C G G C G | | | | T T G G A A C A A A AGGCC T - A C - G C - G C - G G + T T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |