Sequence ID | >WENV170001170 |
Genome ID | AGBK01000257 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 735 |
End posion on genome | 810 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
cttttctggt |
tRNA gene sequence |
AGCCCCGTGGTGTAGGGGTCAAGCATACGGGGTTTTGGTCCCCGCGACGGCGGTTCGAAT |
Downstream region at tRNA end position |
cctattaaag |
Secondary structure (Cloverleaf model) | >WENV170001170 Gln TTG t ACTA cctattaaag A - T G - C C - G C - G C - G C - G G - C T A T C C G C C A G G A G | | | | | G G T G T G G G C G G C G + | | + T T T G C A T C A A A CGAC C - G G - C G - C G - C G - C T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |