Sequence ID | >WENV170001172 |
Genome ID | AGBK01000278 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 1581 |
End posion on genome | 1655 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
taaaggtttT |
tRNA gene sequence |
GTCCCCATCGTCTAGCGGCCTAGGATACTGGGTTTTCATCCCAGCGACAGGGGTTCGAAT |
Downstream region at tRNA end position |
aataagttgg |
Secondary structure (Cloverleaf model) | >WENV170001172 Glu TTC T GTaa aataagttgg G - C T - A C - G C - G C - G C - G A - T T A T T C C C C A C G A C | | | | | G G T C T G A G G G G C G + | | + T T C G G A T C T A A CGAC C - G T - A G - C G - C G - C T T T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |