Sequence ID | >WENV170001173 |
Genome ID | AGBK01000278 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 1740 |
End posion on genome | 1814 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
tggttaaaat |
tRNA gene sequence |
GGGCGAGTAGCTCAGTGGGAGAGCACCTGGCTTACATCCAGGCGGTCATAGGTTCGAGTC |
Downstream region at tRNA end position |
tgaggtcaag |
Secondary structure (Cloverleaf model) | >WENV170001173 Val TAC t ACCA tgaggtcaag G - C G - C G - C C - G G - C A - T G - C T G T T A T C C A G A A | | | | | G T C T C G A T A G G C G | | | | T T G G A G C G A A CGGTC C - G C - G T - A G - C G - C C T T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |