Sequence ID | >WENV170001174 |
Genome ID | AGBK01000278 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 1824 |
End posion on genome | 1902 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
atgaggtcaa |
tRNA gene sequence |
GGGGATGTGGTCCAGCCTGGCCCAAGACGCTTGATTGTCACTCAAGAGATCGCCGGTTCA |
Downstream region at tRNA end position |
aaaacttttt |
Secondary structure (Cloverleaf model) | >WENV170001174 Asp GTC a GCCA aaaacttttt G - C G - C G - C G - C A - T T + G G - C T A T T G G C C A C C G A G + | | | | A T C C T G G C C G G C G | | | T T G A G A C C C C A G AGATC C - G T - A T - A G - C A - T T C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |