Sequence ID | >WENV170001175 |
Genome ID | AGBK01000278 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 1935 |
End posion on genome | 2010 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
ttatatcagt |
tRNA gene sequence |
GCCGAGGTAGCTCAGGAGGTAGAGCACCGCCCTGAAAAGGCGGGTGTCCCCAGTTCGACT |
Downstream region at tRNA end position |
atttatttca |
Secondary structure (Cloverleaf model) | >WENV170001175 Phe GAA t ACCA atttatttca G - C C - G C - G G - C A - T G - C G - C T C T G G G T C A G G A A | | | | | G A C T C G C C C A G C G | | | | T T G G A G C T A A GTGTC C - G C - G G - C C - G C - G C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |