Sequence ID | >WENV170001177 |
Genome ID | AGBK01000400 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 2176 |
End posion on genome | 2248 |
Amino Acid | Arg |
Anticodon | GCG |
Upstream region at tRNA start position |
gttatatctt |
tRNA gene sequence |
GGGCCCGTGGTCCAGTGGACAAGACGCGGGATTGCGGATCCTGTAACCCGGGTTCAAATC |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170001177 Arg GCG t GCnn nnnnnnnnnn G - C G - C G - C C - G C - G C - G G - C T A T G G C C C A T G A G | | | | | A G C C T G C C G G G C G | | | T T A A G A C C A G TAAC C - G G + T G - C G - C A - T T A T G G C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |