Sequence ID | >WENV170001178 |
Genome ID | AGBK01000464 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 624 |
End posion on genome | 698 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
ttctaaacga |
tRNA gene sequence |
GCGGGCGTAGCTCAGCGGTAGAGCGACTGATTGCCATTCAGTAGGTCGCGAGTTCAAATC |
Downstream region at tRNA end position |
ctttttattt |
Secondary structure (Cloverleaf model) | >WENV170001178 Gly GCC a TCCA ctttttattt G - C C - G G - C G - C G - C C - G G - C T A T T G C T C A G A A + | | | | A C C T C G G C G A G C G | | | | T T G G A G C T A G AGGTC A - T C - G T - A G - C A - T T T T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |