Sequence ID | >WENV170001179 |
Genome ID | AGBK01000464 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 980 |
End posion on genome | 1056 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aataaaacat |
tRNA gene sequence |
CGTGGGGTGGAGCAATTAGGAAGCTCGTCGGGCTCATAACCCGGAGGTTGTCGGTTCGAA |
Downstream region at tRNA end position |
gatttggccg |
Secondary structure (Cloverleaf model) | >WENV170001179 Met CAT t ACCA gatttggccg C A G - C T + G G - C G - C G - C G - C T A T C G G C C A T A A G | + | | | G T C G A G G T C G G C A | | | | T T G G C T C G A A G AGGTT T + G C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |